circad | circRNAs associated with diseases

hsa_circ_0001649
Gene	SHPRH	Organism	Human
Genome Locus	chr6:146209155-146216113:-	Build	hg19
Disease	Digestive System Neoplasm	ICD-10	Overlapping lesion of digestive system (C26.8)
DBLink	Link to database	PMID	28167847
Experimental Method
Sample Type	Tissues	Comparison	Gastric Cancer (GC) tissue compared with their paired paracancerous histological normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AATGCTGAAAACTGCTGAGAGAA Reverse TTGAGAAAACGAGTGCTTTGG	Statistics	Fold Change : Downregulated pvalue : p=0.039
Citation
Li, WH, Song, YC, Zhang, H, Zhou, ZJ, Xie, X, Zeng, QN, Guo, K, Wang, T, Xia, P, Chang, DM (2017). Decreased Expression of Hsa_circ_00001649 in Gastric Cancer and Its Clinical Significance. Dis. Markers, 2017:4587698.